Processing
IDT miRNA Inhibitors
These steric blocking oligonucleotides hybridize to mature miRNAs and inhibit their function. IDT miRNA Inhibitors are RNA oligonucleotides comprised of 2'-O-methyl residues that confer increased binding affinity to RNA targets and resistance to endonuclease degradation. ZEN modifications are included to block exonuclease degradation.
- Effectively inhibit miRNA function in vitro using low nanomolar concentrations
- Ensure sufficient miRNA knockdown with highly potent, highly specific reagents
- Simplify your experiments with intuitive design and ordering tools
Product details
The standard method for inhibiting microRNA (miRNA) function is by steric blocking, using an oligonucleotide that is perfectly complementary to the mature miRNA target. These inhibitors form a duplex with the miRNA guide strand and prevent the miRNA from binding to its intended target. Note that miRNA function is based on recognition of a seed region rather than complete homology between miRNA and target. Therefore, a single miRNA can regulate tens to hundreds of genes whose sequences do not share exact complementarity with the miRNA.
For effective miRNA inhibition, the binding affinity between the oligo inhibitor and the miRNA must be significantly higher than that between
Adding a 2′ modification to ribose sugars in the RNA backbone can increase Tm and confer resistance to endonucleases [1]. 2′-O-Methyl RNA (2′OMe) is a naturally occurring, nontoxic nucleic acid with a high binding affinity for RNA that provides the required resistance to mammalian endonucleases. Adding ZEN modifications to the termini of 2′OMe-modified oligonucleotides further increases the binding affinity of the miRNA inhibitors and confers resistance to exonucleases [1].
Where to find miRNA sequences
Mature miRNA sequences can be found in the miRNA database, miRBase [2–5]. Just copy the mature sequence for each miRNA and paste it into the IDT miRNA Inhibitor ordering tool.
Controls
We recommend using the following positive and negative controls for your miRNA modulation experiments.
Positive controls
miRNAs are expressed at various levels in different cell types; therefore, it can be difficult to find a good positive control. Ensure that the positive control that you select is expressed at sufficiently high levels to enable measurement of response.
An miRNA that can serve as a good positive control in many situations is miR-21-5p, which is conserved in many species and expressed at high levels in HeLa cells. Protein modulation can be confirmed by measuring expression of endogenous miR-21 targets, such as PTEN [6] and PDCD4 [6–9], or using a reporter assay.
| Species | Mature miR-21-5p sequence* (copy and paste into IDT miRNA Inhibitor ordering tool) |
|---|---|
| Human, mouse, rat | uagcuuaucagacugauguuga |
* Note: The ordering tool will convert the mature miRNA sequence to the complementary sequence with 2′OMe and ZEN modifications for added stability. Mouse miRNA is miR-21a-5p.
Negative controls
A good negative control should be inert and not modulate any genes in the system under study. This is difficult to achieve; however, we propose 2 negative control sequences that we have used throughout our product development and validation process, and which we have found to work very well in vitro and in vivo.
| Species | Sequence* (copy and paste into IDT miRNA Inhibitor ordering tool) |
|---|---|
| NC1 Negative Control (human) | ucguuaaucggcuauaauacgc |
| NC5 Negative Control (human, mouse, rat) | accauauugcgcguauagucgc |
* Note: The ordering tool will convert the mature miRNA sequence to the complementary sequence with 2′OMe and ZEN modifications for added stability.
References
- Lennox, KA, Owczarzy R, et al. (2013) Improved performance of anti-miRNA oligonucleotides using a novel non-nucleotide modifier. Mol Ther Nucleic Acids, 2:e117.
- Kozomara A, Griffiths-Jones S (2011) miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res, 39(Database Issue)
:D152 –157. - Griffiths-Jones S, Saini HK, et al. (2008) miRBase: tools for microRNA genomics. Nucleic Acids Res, 36(Database Issue)
:D154 –158. - Griffiths-Jones S, Grocock RJ, et al. (2006) miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res, 34(Database Issue):D140–144.
- Frankel LB, Christoffersen NR, et al. (2008) Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem, 283(2):1026–1033.
- Lu Z, Liu M, et al. (2008) MicroRNA-21 promotes cell transformation by targeting the programmed cell death 4
gene . Oncogene, 27(31):4373–4379. - Yao Q, Xu H, et al. (2009) MicroRNA-21 promotes cell proliferation and down-regulates the expression of programmed cell death 4 (PDCD4) in HeLa cervical carcinoma cells. Biochem Biophys Res Commun, 388(3):539–542.
Performance
The success of miRNA inhibition experiments is dependent on several factors, the most important of which are potency, specificity, stability, and toxicity. High potency ensures that only small doses are required to produce the desired phenotype, also reducing toxicity of the administered compound. miRNA inhibitors that are specific to their target reduce the incidence of off-target effects, ensuring that any observed phenotypes are the result of the effect on the target under investigation. Stability and low toxicity are essential for in vivo experiments.
Figures 1–4 demonstrate the high potency, specificity, stability, and extremely low toxicity of IDT miRNA Inhibitors compared to other modified oligonucleotides.
Modifications tested in miRNA inhibition experiments
RNA or DNA oligonucleotides were designed to target miR-21. The sequences are the same, but their modifications vary. See Figures 1–4 for experimental results.
| Name | Sequence1 | |
|---|---|---|
| IDT miRNA Inhibitors | mU/ZEN/mCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmUmA/3ZEN/ | |
| DNA | TCAACATCAGTCTGATAAGCTA | |
| 2′OMe |
| |
| 2′OMe 3PS Ends |
| |
| 2′OMe 3′inZEN | mUmCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmU/ZEN/mA | |
| 2′OMe 5′inZEN | mU/ZEN/mCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmUmA | |
| 2′OMe 3′inC3 | mUmCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmU/iSpC3/mA | |
| 2′OMe 5′inC3 | mU/iSpC3/mCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmUmA | |
| 2′OMe 5′inC3, 3′inC3 (2′OMe 2XC3) | mU/iSpC3/mCmAmAmCmAmUmCmAmGmUmCmUmGmAmUmAmAmGmCmU/iSpC3/mA |
* A/T/C/G = DNA base; mA/mU/mC/mG = 2′ O-methyl (2′OMe) RNA base; * = phosphorothioate (PS) linkage; /ZEN/ or /3ZEN/ = internal or 3′ ZEN modification, respectively; /iSpC3/ = internal C3 spacer.
High potency of IDT miRNA Inhibitors
Figure 1. IDT miRNA Inhibitors exhibit high potency. Oligonucleotides designed to target miR-21 were transfected at 0.3–30 nM in HeLa cells expressing the psiCHECK-miR-21 plasmid using Lipofectamine® RNAiMAX transfection reagent (Thermo Fisher). The cells were lysed after 24 hr and analyzed for luciferase activity. Results were normalized with the internal firefly luciferase (FLuc) control and are shown as fold change in Renilla luciferase ( RLuc) compared with the lipid reagent control, which was set at 1. Tm values for the various oligos are shown above the respective profiles.
High specificity of IDT miRNA Inhibitors
miRNA inhibitors with various modifications were tested against wild-type miR-21 and 3 "mutant" versions containing 1, 2, or 3 mismatches (Table 1). IDT miRNA Inhibitors demonstrated high specificity at all concentrations tested (Figure 2).
Table 1. Sequences of wild-type and "mutant" miR-21 used to test specificity of miRNA inhibitors.
| Mutant type | miR-21 IDT miRNA Inhibitor sequences (5′ to 3′)* |
|---|---|
| Wild type (0 MUT) | C A A C A U C A G U C U G A U A A G C U |
| 1 MUT | C A A C A U C A G U C A G A U A A G C U |
| 2 MUT | C A A C C U C A G U C A G A U A A G C U |
| 3 MUT | C A A C C U C A G U C A G A U A A C C U |
* Mutated bases are indicated by bold, red notation. Modifications not shown.
Figure 2. IDT miRNA Inhibitors are highly specific. Different miR-21 inhibitors (n = 5) were synthesized, complementary to wild-type miR-21 (0 MUT) or containing 1, 2, or 3 mismatched—1 MUT, 2 MUT, and 3 MUT, respectively. The inhibitors were transfected into HeLa cells expressing the psiCHECK-miR-21 plasmid. After 24 hr, the cells were lysed and analyzed for luciferase activity. Values were normalized with internal firefly luciferase (FLuc) control and reported as a fold change in Renilla luciferase (RLuc) compared with lipid reagent control, which was set at 1.
High nuclease stability of IDT miRNA Inhibitors
Figure 3. IDT miRNA Inhibitors are resistant to nucleases. 1.1 nmol of each oligonucleotide was incubated in (A) 10% FBS, high exonuclease environment; or (B) 20% mouse liver protein extract, high endonuclease environment, for the indicated lengths of time. Each reaction was analyzed on a denaturing polyacrylamide gel stained with methylene blue.
Low cellular toxicity of IDT miRNA Inhibitors
Figure 4. IDT miRNA Inhibitors exhibit low toxicity to cells. Modified oligonucleotides corresponding to a nontargeting negative control sequence, NC1, unrelated to any known human miRNA were transfected into HeLa cells at concentrations of 10, 30, and 100 nM to investigate and compare toxicity. The cells were visualized by phase contrast microscopy (10X magnification).
Resources
User guides and protocols
Frequently asked questions
Services
GMP and OEM
If you require oligos that are approved for use in molecular diagnostics applications, or if you are interested in our OEM services, please click here.
2019 Novel Coronavirus (2019‑nCoV)
Solutions for your research needs. Available now. Ready to ship.
ORDER NOW